Wednesday, October 30, 2019
Global warming Research Paper Example | Topics and Well Written Essays - 1500 words - 2
Global warming - Research Paper Example While considering meat’s entire lifecycle, a meat eater is said to contribute to 1.5 tons more greenhouse gases per year compared to a vegetarian. This fact has been revealed by a study conducted by the University of Chicago (Michael, 2009). By contrast, changing to a hybrid Toyota Prius from a Toyota Camry is expected to help humans get rid of one ton of greenhouse gases per year (Michael, 2009). Global meat production is increasing every year. This is found to be adding more global warming gases. Therefore it is said that one of the easiest ways to decrease the collective greenhouse gas emissions is to consume less meat. Similarly every human activity is blamed to be causing global warming. These findings appear to be amusing when we properly understand the nature of the process, global warming. Global warming is believed to be primarily caused by carbon dioxide emitted into atmosphere through the use of fossil fuels in vehicles. However we forget that natural water cycle is causing much more carbon-dioxide to come in and out of the atmosphere. Even though we cannot deny that human activities are contributing to warming of earth, it would be wrong to comment that global warming is completely human-made. Some of the causes of global warming are in the arctic region. The polar ice caps melt faster than they get evaporated. This process would be reversed in ten to twenty years. Human activities are causing less than three percent of greenhouse gas release into the atmosphere. Average world temperature is gradually increasing; this process is happening in the last one million years. This is long back the human activities started on earth. Global warming has been happening long back industries started emitting greenhouse gases into the atmosphere. We are of the belief that carbon dioxide released into the atmosphere today will negatively affect human beings several hundred years later. This is however not true. The lifespan of carbon dioxide is only 20 year s. After 20 years, the emitted carbon dioxide would completely disappear from atmosphere. Sun has little role in heating the atmosphere. The high frequency radiation of sun does not heat atmosphere. Hot bodies like sun cannot release low frequency radiation called infrared radiation. Rather, the heat from the sun heats the earth’s surface. This process reduces the radiation to infrared. Heat moves into the atmosphere by different processes like conduction, convection and evaporation. The infrared radiation gets absorbed by carbon dioxide. Instead, the sun’s rays heats the Earth’s surface, this weakens the radiation to infrared. From there it moves in to the earth’s atmosphere by any means necessary (Conduction, convection, evaporation). Then the inferred radiation is absorbed by the CO2. Almost 97 percent of the heat in the atmosphere is caused by evaporation or convection. Greenhouse gases are not responsible for this warming of atmosphere (Mintzer, 1992 ). The climatic changes of these ages are negligible compared to the climatic changes of the ancient periods (Mintzer, 1992) (Mike, 2006). Water evaporation is the chief cause of global warming. Water evaporation is causing global warming 100 times more than carbon dioxide emission (Mike, 2006). Human activities
Monday, October 28, 2019
Economics of the movie business Essay Example for Free
Economics of the movie business Essay Most of the movies that are eventually released are cofinanced. This is a term that is used within the movie industry to describe those films for which there are more than one firm that share both the cost of production as well as the revenues. Nearly one-third of all the movies that are released are cofinanced. Various studies have shown that the main reason for cofinancing is to manage and share risk. Most of the major studios are in the category of publicly traded firms where the investors are free to carry out their own diversification decisions. Not always is the cofinancing decision related to the movie returns as the studios rarely cofinance highly risky films1. Demand is difficult to predict and thus financial risk remains to be a characteristic of the film industry since most of the cost is incurred long before the demand can be actualized. It’s thus the reason that most of the authors in this field have argued that the key variable that shapes the industry is the financing strategy adopted. Mainly, there are three ways in which cofinancing would reduce risk associated with the movie production. First, the cofinancing of the relatively risky films by the studios would give them the opportunity to participate in the less risky projects. Second, cofinancing would allow studios to fine tune their portfolios thus gaining the advantage of covariances of the gains across the movies. The third advantage of cofinancing is the simple law of large numbers to share a potential loss . Data collection The data to be used here in this paper is the information provided forth in Goettler, R. L and Leslie, P. (2004) where information on over 3,826 movies was exhibited in the US between 1987 to 2000. The primary source of the data was the Internet Movie Database (IMDb). The analysis focused mainly on ownership choices of the major studios. Out of the 3,826 movies examined, 1,305 were produced by the major studios. The analysis here focuses on ownership choices that have been made by the major studios. Movie profitability has been based on the return on investment, RIO, which is defined as the revenue divided by the cost. Revenue in this case was measured as the North America box office revenue and cost was obtained from the production budget. Film’s negative cost, which is the standard measure of production cost was also used. Other cost such as advertising are in most cases proportional to the cost of production and were thus not evaluated in this kind of study. Thus the ROI evaluated here was basically the relative profitability of the films but not the absolute profitability. Also the measure of revenues in this study excluded some revenues such as foreign box and video revenue. It would be ideal to use all the revenue sources but the approach would have limited the number of films in the analysis as most of this kind of data is only available only to a subset of films. At the same time limiting the analysis only to the films with this kind of extra data may introduce selection bias as most of this data maybe limited to the successful films only1. Identification of cofinanced films The listing of a production company is the first sign that there are cofinancing partners but this is not a sufficient condition. The most important criteria is to know if a firm contributes towards the production cost. Its worth to note that a firm can be credited for having contributed into the production company of a film after initiating then selling the project to a major studio even without retaining revenue shares. This kind of arrangement referred to as â€Å"first-look deal†is common between a semi-independent production company and a studio in a long-term relationship. The criteria used here in determining if a film is cofinanced is that first if a major studio is on the list of the production company for a certain film, then the assumption is that the studio has some ownership stake in the film. Second, Variety magazine was a source of those firms with the first-look deals from the â€Å"Facts on Pacts†list and those that are equity partners. The assumption here was that a firm was a joint owner if it was on the production company list and also on the equity partner2. For those movie that an independent firm and a major studio cofinanced, the question of whether either of these two had the option of being sole-owner remains. In simple term, one may also question which among the two firms initiated the entire project? The available information suggest that the studio usually has the mandate to decide if it will co-own or just be a sole-owner. This kind of decision called â€Å"greenlighting†is usually made during decision point of whether to make the movie or not. Complications do arise like when two companies have the same subsidiary structure such as having the same parent company and at the same time end up owning the same movie. In such cases, it was assumed that the movie was not cofinanced since the production divisions happen to work as integrated components of the parent studio rather than as being competitors. Another point of ownership ignored was the cases where the directors or the star actors negotiate a part of the movie revenues. This was so because most of this happens as a result of the directors/actors strong bargaining power to have a share of the revenue once the movie is successful rather than a strong will to share and manage risk.
Saturday, October 26, 2019
Boer War - The Causes :: African Africa History
Boer War - The Causes There were significant political conflicts between the two sides. The Boers treated all blacks very badly and did not give basic human rights even to the blacks working for them. They made them pay taxes but could not vote. It was said to be through religious reasons that the Boers treated blacks so badly. This awful treatment infuriated the British, who had abolished slavery in all its colonies as well as at home in 1834. The Dutch wanted to keep its slaves. Europeans working in the Boer territories were also mistreated. These "Uitlanders" as they were known were key to the Boers' economic success, yet were still denied the vote. The war occurred also because of strategic reasons. The British had already seized Swaziland, Bechuanaland and Basutoland, which more or less surrounded the Boers who feared that if the British took any more territory, they could be under siege, particularly if their route to the sea was blocked. The British wanted to control all of Southern Africa, not just small areas which were isolated - the Boers were their main opponents. There were economic issues involved in the war. The Boers took control of the Transvaal and set up the Orange Free State. They found gold in the Transvaal and this area became very rich indeed. Later diamonds were found in this area as well, and there was argument between the British and Boers over in which nation's territory they lay. Certain individuals had a major role in provoking the war. Cecil Rhodes was probably the most ambitious of Britain's leaders abroad. He was a real imperialist, and strove to expand the British Empire further, especially through his dream of a "Cape Colony to Cairo" railway. He was strongly anti-Boer, and his actions seemed to shape British policy back at home. Also highly influential was Sir Alfred Milner, who was the British High Commissioner and was also strongly anti-Boer. He was supposed to be a peacemaker, but it were the demands he placed on the Boers which sparked the war, and he ended up looking more like a warmonger. Paul Kruger, President of the Transvaal and leader of the Boers, did not want to give in to the Uitlanders, since he feared he would lose his position if they were given the vote. It was he who had ordered the first attack against the British in 1881.
Thursday, October 24, 2019
African American Life Before and After Emancipation Essay -- American
African American Life Before and After Emancipation Slavery was an intrinsic part of North American history from the founding of the Jamestown colony in 1607 to the legal abolition of servitude in 1865. But our nation continues to grapple with the economic, political, social, and cultural impact of that peculiar institution to this day. Over seventy years after the end of the Civil War, the WPA Federal Writer’s Project sought to understand the impact which slavery had on the lives of African Americans who once lived under its yoke. In 1936-38, the Writer’s Project sent out-of-work writers to seventeen states to record the personal narratives of former slaves; the result was an outpouring of nearly 3,000 stories from men and women who were born into bondage and released into uncertain freedom early in their lives. The relatively small collection of 26 narratives gathered in Mississippi in these years reveals the complexities of African American life before and after emancipation. While this sample should not be read as indicative of the memory and experience of former slaves at large, it does raise important questions about the meaning of freedom, the failures of Reconstruction, and the perceived quality of life for blacks during and after slavery. A careful reading of the Mississippi narratives reveals nostalgia for the security and stability of slavery and an overwhelming dissatisfaction with the failed promises of freedom: â€Å"turned †¦ loose, †¦ lak a passel o’ cattle,†former slaves struggled to realize the concrete benefits of an abstract freedom and longed for better days;[1] This weary nostalgia must be recognized not as a rejection of freedom, but as a denunciation of the powers, which declared them fr... ... [30] Sam McCallum, 4. American Memory: Born in Slavery. [31] Foner, 159. [32] Charlie Davenport, 8. American Memory: Born in Slavery. [33] Foner, 246. [34] James Lucas, 7-8. American Memory: Born in Slavery. [35] Foner, 376. [36] James Lucas, 7. American Memory: Born in Slavery. [37] Foner, 54-56. [38] Foner, 107. [39] James Cornelius, 3. American Memory: Born in Slavery. [40] Foner, 82. [41] Foner, 78. [42] Anna Baker, 5. American Memory: Born in Slavery. [43] Nettie Henry, 1-2. American Memory: Born in Slavery. [44] Jane Sutton, 5. American Memory: Born in Slavery. [45] Foner, 96; 366. [46] Wayne Holiday, 2. American Memory: Born in Slavery. [47] Isaac Stier, 5. American Memory: Born in Slavery. [48] Henri Necaise, 4. American Memory: Born in Slavery. [49] Dora Franks, 3. American Memory: Born in Slavery. African American Life Before and After Emancipation Essay -- American African American Life Before and After Emancipation Slavery was an intrinsic part of North American history from the founding of the Jamestown colony in 1607 to the legal abolition of servitude in 1865. But our nation continues to grapple with the economic, political, social, and cultural impact of that peculiar institution to this day. Over seventy years after the end of the Civil War, the WPA Federal Writer’s Project sought to understand the impact which slavery had on the lives of African Americans who once lived under its yoke. In 1936-38, the Writer’s Project sent out-of-work writers to seventeen states to record the personal narratives of former slaves; the result was an outpouring of nearly 3,000 stories from men and women who were born into bondage and released into uncertain freedom early in their lives. The relatively small collection of 26 narratives gathered in Mississippi in these years reveals the complexities of African American life before and after emancipation. While this sample should not be read as indicative of the memory and experience of former slaves at large, it does raise important questions about the meaning of freedom, the failures of Reconstruction, and the perceived quality of life for blacks during and after slavery. A careful reading of the Mississippi narratives reveals nostalgia for the security and stability of slavery and an overwhelming dissatisfaction with the failed promises of freedom: â€Å"turned †¦ loose, †¦ lak a passel o’ cattle,†former slaves struggled to realize the concrete benefits of an abstract freedom and longed for better days;[1] This weary nostalgia must be recognized not as a rejection of freedom, but as a denunciation of the powers, which declared them fr... ... [30] Sam McCallum, 4. American Memory: Born in Slavery. [31] Foner, 159. [32] Charlie Davenport, 8. American Memory: Born in Slavery. [33] Foner, 246. [34] James Lucas, 7-8. American Memory: Born in Slavery. [35] Foner, 376. [36] James Lucas, 7. American Memory: Born in Slavery. [37] Foner, 54-56. [38] Foner, 107. [39] James Cornelius, 3. American Memory: Born in Slavery. [40] Foner, 82. [41] Foner, 78. [42] Anna Baker, 5. American Memory: Born in Slavery. [43] Nettie Henry, 1-2. American Memory: Born in Slavery. [44] Jane Sutton, 5. American Memory: Born in Slavery. [45] Foner, 96; 366. [46] Wayne Holiday, 2. American Memory: Born in Slavery. [47] Isaac Stier, 5. American Memory: Born in Slavery. [48] Henri Necaise, 4. American Memory: Born in Slavery. [49] Dora Franks, 3. American Memory: Born in Slavery.
Wednesday, October 23, 2019
Human Behavior Essay
Human behavior can negatively or positively affect the environment. Environmental settings such as pollution, crowding, heat, or noise may be a source of that can negatively impact the environmental quality, conditions. The environment can be positively impacted by structures, green areas or health facilities. There are simple solutions that can help in getting started with these efforts. Explain how environmental cues shape behavior and provide at least one example Environmental cues are the normal elements that the general public does not control. For this reason, individuals are required to obey the rules with regard to the environmental cues. Examples would be the environmental cues such as sustenance accessibility and high temperature fluctuations commonly upset the nourishing routines of wildlife. A grocery store, as another example can has been sensibly designed to give the experience to take full advantage of the amount of money you will spend by the time you walk out. This i ncludes fundamentals like inserting necessities such as milk and eggs on the furthest side from the entry so you have to walk through additional lanes to get there, placing foods with kid appeal on lower shelves so they can see and request it, as well as placing impulse objects by the cash registers to get your attention while waiting in line. Even the smell drifting from the bakery has been intended to increase the amount of items in your shopping cart. The human mind typically takes part in certain actions centered on the familiar environmental cues and patterns. If people gather in an environment where the use of drugs is rampant, this means that majority of the population will take on to this behavior without bearing in mind the harmful effects that their acts could have in the long run. This means that human beings have a part of planting something in the environment that can generate change and reduce the negative effects that are currently experienced. A good model would be implementation of a practice to make use of decomposable bags for grocery shopping as a replacement for the disposable plastics. This is because the plastics ordinarily have harmful effects on the environment in several ways. People typically do not dispose of the correctly and they have the potential of being a health risk to animals if they happen to swallow them while eating. The implementation of this method will influence the environment positively in the long run because the behaviors of people will change accordingly. Evaluate how behavior can be modified to support sustainability and how this can limit a negative impact on the environment Behavior can be modified for example in our daily activities. Most people wake up in the more and brush their teeth as well as shower. Both of these activities require using water. Instead of letting the water run constantly while engaging in these activities a person can turn the water off while brushing and only use as needed or when showering rinse with the water to get wet then turn off while lathering up and back onto rinse off. This will all lessen the time the water is being used for less waste. When grocery shopping a person can elect to use either paper or their own environmentally safe bags for shopping. Sometimes a person tends to utilize their car out of habit and convenience. Instead of driving to the corner store a person may elect to walk or ride a bicycle. This in turn will reduce the amount of pollutants released in the air, also affording exercise for the individual. Describe how social norms influence behavior and beliefs about the environment Social norms affect t he method in which people conduct themselves, depending on the communal experiences and what the society expects of them. With the current generation nonetheless, these social norms have been washed away in many communities and this has had a very negative impact on the environment as well as the society at large. For instance, smoking was strictly prohibited for students and other younger generations. This is currently not the case as campus students are leading in smoking. This on the other hand has impacted the environment in a negative manner. Smoking on campus is still a problem and imposes a health risk for students and negative environmental impacts. There is a need to protect students, faculty and staff from exposure to second hand smoke on college campuses and create anticipation that this living and working environment be smoke free. The argument that a person who smokes in the campus exposes the other nonsmokers to second hand smoke, something which can have negative effects to both their health. There are policies that can be implemented in campus to lessening the rate of smoking and chan ge the current attitudes of students towards this act. This is actually proven from the findings that students who study in areas where smoking is prohibited do not smoke at all in their entire lives. Smoking on campus has become widespread in spite of the health and environmental effects that are connected with this act. This is something that is raising voices of many advocates and particularly because of the negative effects that are connected with it. The worst part is that the people who do not smoke are also affected from the discharged smoke. It is consequently significant to come up with guidelines that will help in removing this act. This is the only way in which the environment will be kept and the health effects connected with smoking with diminish considerably. Identify at least two possible solutions that could successfully change behavior and habits in order to lessen negative environmental impact There are several possible solutions to possibly change the behaviors and habits that negatively affect the environment. The option of utilizing public transportation in turns reduces the fact of at least one extra vehicle being on the road that will cause pollution. Once people get rid of the negative associations that come with using public transportation. Another method would be to use energy efficient appliances. An individual can start off by replacing all the light bulbs in the house with energy efficient ones. Also replacing appliances to conserve the environment over a period of time. There are many things that individuals can do on a daily basis to positively impact the environment. It may be easier to start out in small steps maybe within the individual household, then work towards others on the outside. Any step or effort made is a positive step in the right direction. Changing the behavior and effects on the environment takes the work of all individuals that share this Earth. One person can only make so much of a difference. References Festinger, L. (2009). An Introduction to the Theory of Dissonance Vergragt, P. (2006). How Technology Could Contribute to a Sustainable World. Vries, H. D., Backbier, E., Kok, G. and Dijkstra, M. (2006), The Impact of Social Influences in the Context of Attitude, Self-Efficacy, Intention, and Previous Behavior as Predictors of Smoking Onset. Journal of Applied Social Psychology
Tuesday, October 22, 2019
Beautyism and Friends
Beautyism and Friends Beautyism and Friends Beautyism and Friends By Maeve Maddox It’s not in my two main dictionaries yet, but beautyism has found a place in the catalogue of English words ending in -ism: Beautyism in the Workplace: Disguised Discrimination Jawahar and Mattsson (2005) investigated sexism and beautyism effects in employment processes using experimental research. The suffix -ism has been a prolific source of English nouns since the Middle Ages, but this newest use, to form words that denote perceived superiority or discrimination, is fairly recent and has produced the following nouns: ageism: Prejudice or discrimination on the grounds of a persons age; age discrimination, especially against the elderly. racism: prejudice and antagonism towards people of other races, especially those felt to be a threat to ones cultural or racial integrity or economic well-being. sexism: prejudice, stereotyping, or discrimination, typically against women, on the basis of sex. beautyism: prejudice, stereotyping, or discrimination on the basis of physical attractiveness or lack of it. On the Ngram chart, the word racism begins a dramatic rise in the 1930s. Sexism and ageism begin their rise at the end of the 1960s. Beautyism barely shows in comparison with the others, but is on the graph beginning in 1971. The OED added these additional definitions for the use of the suffix -ism in 2004: a. Forming nouns with the sense ‘belief in the superiority of one [something] over another’; as racism, sexism, speciesism, etc. b. Forming nouns with the sense ‘discrimination or prejudice against on the basis of [something]; as ageism, bodyism, heightism, faceism, lookism, sizeism, weightism, etc. Some other uses of -ism To form nouns that name the process or completed action of a verb in -ize: baptize/baptism criticize/criticism, exorcize/exorcism plagiarize/plagiarism ostracize/ostracism To form nouns that name the action or conduct of a class of persons: hero/heroism patriot/patriotism despot/despotism To form the name of a system of theory or practice, sometimes on the name of the subject or object, and sometimes on the name of its founder: Arianism Buddhism Conservatism Puritanism Platonism Feminism To form a noun denoting a peculiarity or characteristic, especially of language: Americanism Gallicism archaism colloquialism solecism sophism witticism Want to improve your English in five minutes a day? Get a subscription and start receiving our writing tips and exercises daily! Keep learning! Browse the Vocabulary category, check our popular posts, or choose a related post below:36 Adjectives Describing Light10 Types of TransitionsQuiet or Quite?
Monday, October 21, 2019
Inventory management methods at Carrefour in UAE
Inventory management methods at Carrefour in UAE Introduction Inventory management refers to the process by which a business organization maintains an organized flow of goods in and out of the business enterprise. In so doing the organization team attempts to prevent the inventory becoming high or on the hand going down to levels that can affect the performance of the organization.Advertising We will write a custom research paper sample on Inventory management methods at Carrefour in UAE specifically for you for only $16.05 $11/page Learn More According to Watson (p 32) in order to control the inventory management the people involved should zero in on some aspects that will act as a guide to them. The most important aspect regards to time keeping. He says that by keeping the inventory management the managing team is able to establish the amount of time spent in order for a distributor to process what has been ordered and also deliver. In addition he says that the inventory management helps in determining t he period that it has taken for a good delivered in the business to move out having being sold. Therefore bearing this in mind the management team is able to determine with minimal errors when to place an order of a particular commodity and of what quantity. To add on that he argues that inventory management helps in maintaining of accurate records of what has been delivered and what has been sold. As a result any cases of missing goods or varying figures in the receipts books can be cross checked in order to establish the correct figures. For taxation purposes the inventory management has been argued as adequate in providing the information required. Types of inventory management As the business strives to move forward it has to maintain a good inventory management so that it can be known what is required when, and in what quantity. It is as a result of this the management team has an option of choosing from a number of available inventory management. Today there are four major typ es of inventory management. They include the material requirements planning, multi echelon inventory optimization, single echelon inventory optimization, and the just in time inventory management system. Material Requirements Planning (MRP) According to Howard (p 121) under this type of inventory management the main emphasis is placed on the production schedules so that there is optimization of inventory levels. He argues that material requirement planning demands that inventory should be available in large quantities to ensure that they perform accordingly in the task required of them.Advertising Looking for research paper on business economics? Let's see if we can help you! Get your first paper with 15% OFF Learn More To add on that he states that inventory should be availed in time so that the business organization reduces the amount of money incurred. When using the material requirement planning the main component of it is the Bill of Material. According to him the Bill of Material is very useful in a business enterprise since it is the one used when it comes to the calculation of time that is needed to acquire raw materials used during the process of production. Single Echelon Inventory Optimization Watson (p 23) argues that single echelon inventory optimization is mainly used by the business organization that wants to maintain a single channel for distribution between itself and its clients. Due to its simplicity, he argues that this type of inventory management is used in large numbers by the small and medium business enterprises that have limited inventory channels of distribution. Multi-Echelon Inventory Optimization Contrary to the single echelon inventory optimization, this type of inventory management is mainly a reserve of the business enterprises that have many regional centers of distribution and also a number of centers to distribute their products. Just In Time (JIT) According to Howard (p 126) this inventory managemen t system is designed in such a way the company or the business organization is able to have a minimum inventory holding costs. He notes that under this system the business organization should only place an order to the supplier after that particular good has been asked for by a customer. He says that the company in most of the time has in the shelves what they think is the goods asked for by the customers in many incidences. As a result Watson (p 25) argues that the company ensures that their inventory holding costs are low and that way they do not stand a chance of non moving goods within their enterprise. What are the methods used in Carrefour UAE Carrefour is a retail chain from France that for over the last 40 years emerged as one of the leading retail outlets all over the world in terms of revenue collected, profit, and the number of staff employed. During that period Carrefour has managed to establish many outlets in different parts of the world particularly in Europe, South A merica, North Africa, and the Middle East.Advertising We will write a custom research paper sample on Inventory management methods at Carrefour in UAE specifically for you for only $16.05 $11/page Learn More Therefore, various scholars have looked at the measure put in place in order to achieve this success that many other retail outlets in different parts of the world have not been able to do. In their discussion one common feature that they all talk about is the use of efficient inventory management in order to control the movement of their stock. According to Muller (p 232) within the Carrefour business the most used inventory management system is the Just In Time (JIT). As earlier discussed this kind of inventory management system is greatly beneficial to the company because in one way it helps the company not to stock non moving goods which can in the long run play a part in making the company realize a loss. Under this system the company receives an o rder of a certain commodity from the client. In response the company places an order from the supplier for that commodity to be delivered. Once brought to the company, the commodity is taken to the client’s house hold. Using the Just In Time method the company is guaranteed that the goods they have in stock especially the heavy house hold items like fridge, and other electronics goods are bound to be bought because they are in stock because the customers asked for them. However, other frequently used house hold goods are usually stocked without using the Just In Time inventory system. In addition to that Institute of Grocery Distribution (p 235) argues that Material Requirements Planning (MRP) is also used in the Carrefour business. They say that when using this inventory management, the company is able to ensure that their orders are processed on time by the suppliers. Although this is not used most of the time, they argues that it is useful to the company because the stock in business enterprise is closely monitored and therefore appropriate measures put in place to mare sure that no stock runs out without new one being ordered.Advertising Looking for research paper on business economics? Let's see if we can help you! Get your first paper with 15% OFF Learn More As a result of this the clients would always find most of the things that they have come to shop. An example of the goods that may fall under this category of inventory management system is the household goods that are used by many people in their homes such as food stuffs and drinks. Multi Echelon Inventory Optimization on the other hand is used when it comes to the distribution of goods to the company branches. According to Koontz (p 476) Carrefour is a business enterprise with many outlets being found in various cities I the United Arab Emirates. Such cities include Abu Dhabi, Dubai, and Sharja. Therefore, to coordinate the activities of these outlets there is need to have a central position from which goods are distributed to the outlets. As a result of this the people working in the distributing centre has to maintain the Multi Echelon Inventory Optimization so that they can easily record and know the amount of stock disbursed to a certain outlet. Using this method the company is able to maintain a tracking system to know if the goods were taken to their intended destination. He therefore argue that chances of doctoring figures on the way are minimized and this goes a long way in making sure that the company profits continue to grow in leaps and bounds. Today Carrefour in United Arab Emirates has invested a lot of money in the information technology as well as communication so that they can track their sales and merchandise inventories in the entire branches in the country. In so doing the company has been able to reduce unproductive inventory by a way of letting the outlets manage their own stocks. Instead of reducing inventory across the board, Carrefour management has used its advanced information technology system to avail many inventories for goods demanded for mostly by the clients. In so doing the company has been able to keep their inventory levels as low as possible. Furthermore, the company has also been using bar coding and radio frequency tech nology in managing her inventories. Under this method the goods are directed to the dock from where they are loaded for shipments. The bar coding that they use helps them to pick and receive good inventory control. In addition this system helps in easier counting of the inventories physically. Advantages of Inventory Management In any business enterprise whether small or big inventory is very important because it helps the business maintain the required inventory levels to avoid incurring unnecessary costs. Inventory management has a number of advantages that include the following. Inventory management helps in understanding the demand and supply. Therefore the company avoids stocking too much of unwanted goods or under stocking. This is because maintaining the inventory management helps in establishing the trends of goods movement. In addition maintaining inventory management helps the company reduce liabilities. Koontz (p 467) says that by looking at the movement of goods out of t he shop, the management of the business can know when to buy certain goods and in what quantities to avoid over stocking that may lead to losses. Therefore by maintaining inventory management chances of stocking unwanted goods are minimized. Other advantage is that it helps the management knows when to make orders of certain goods and also stream line its operations. Disadvantages of Inventory Management According to Muller (p 231) inventory management has been noted to have three disadvantages that include the following. At first is the bureaucracy that gives a lee way to the employees to manipulate the available stock in the business. Secondly we have the production problem he says that although the company is able to know the stock available, it is not able to know the quality of the goods they are selling. Conclusion In today’s world companies like Carrefour have spread in many parts of the globe as a result of proper planning and efficient management. Therefore, this can be a wake up call to those businesses that has for long been struggling to survive. Maintaining an inventory is paramount in order to identify the movement of goods in and out of the company. Howard, Elizabeth. Carrefour: a study of a hypermarket and its effect. Avon: Avon County Planning Department, 1999. Institute of Grocery Distribution. Carrefour: A Strategic Review. Michigan: Institute of Grocery Distribution, 2002. Koontz. Essentials of management 8E. New York: Tata McGraw Hill Education, 1990. Muller, Mike. Essentials of inventory management. New York: AMACOM Div American Mgmt Assn, 2003. Watson, Anthony. Best practice in inventory management. Abington: Elsevier, 2002.
Sunday, October 20, 2019
My Grandpa essays
My Grandpa essays I am now 15 almost 16 and I can recall being much of a different person a few years ago. Life a few years ago sure was better. Everything used to run smoother and people were rarely sad, but that was when I had my grandpa, he was a good man and a pastor at that. Everyone loved him; he was always there to cheer up people and to give advice to them. I remember going to church veer Sunday, not only to hear about God and all of that, but because my grandpa and my grandma went. Grandma was always with him where ever he went; they were like one; they loved each other so dearly. I remember that my grandpa really wanted to be an evangelist, so that he could travel and preach the word (the Bible) to others, but he always seemed to get stuck to churches for long periods of time. All the churches loved to hear him preach because my grandpa was a whole hearted Christian and believed in what he was saying! I can also remember fun days with him and of course my grandma. One day we all went to Lake Tahoe to go fishing, I was a little girl and I sure wasn't the best fisher. I was such a clumsy fisher that I had accidentally caught my grandpa on his shirt twice; boy-o-boy was that a funny day. My grandpa was the light of my family, when he was around the mood of the house seemed to be more cheerful and more alive. To me my grandpa was invulnerable and nothing could ever happen to him, but I guess that I was wrong. I remember when the happiness of the house was starting to fade because my grandpa was sick. We all thought that he had an ordinary flu or something, but since my grandpa was a hard head and never wanted to go to the doctor we didn't know for sure. One day he just couldnt take it any more, so he went to the hospital. Me I didn't take it as a big deal until we all went up there to see him. I went into his room thinking that he just had some little sickness or something, but then I say him laying there motionless with...
Saturday, October 19, 2019
Adult Learning Assumptions Research Paper Example | Topics and Well Written Essays - 750 words
Adult Learning Assumptions - Research Paper Example Adult learning assumption Learning process is progressive and can occur at any stage of life. Some people may engage in learning from their early stages and pass through the formal education system while others may recognize or access learning opportunities at their later stages of life. While the formal education may not be appropriate for the latter category, an informal adult education exists. Studies have been undertaken on adult education with Knowles’ approach towards assumptions of adult education as an example and this paper argues that three of the Knowles’ assumptions: self-concept, experience, and motivation to learn, are the most right. The self-concept assumption is one of the Knowles’ six assumptions and offers significant impacts on adult education. Knowles argued that as adults’ self-concept is that of a â€Å"self directing human being†(Henry, 2009, p. 127). He argued for a transition from a dependent self-concept to one in which a n adult is an independent personality and an active player in the learning process as opposed to a young learner who assumes a passive role and depends on the lecturer or tutor for learning. Significance of this assumption is derived from the author’s opinion that established it as the most important the understanding adult learning. Cognitive development processes that transcend a person’s life from birth to adulthood also support the assumption’s importance. ... Teachers’ experience in adult education also support significance of the self-concept assumption through their experience that promoting self-concept helps in facilitating adult learning. The role of diversity on performance, including performance in learning, also supports significance of self-concept because recognizing adult learners’ perception towards learning and empowering each learner based on developed self-concept achieves success in each learner. Validity and significance of the self-concept assumption explains why it is right (Wilson and Hayes, 2009). â€Å"The role of the learner’s experience†is another right assumption that Knowles made on adult learning (Baskas, 2013, p. 49). According to Knowles, people acquire varying experiences with age and this means that adults have more experiences that young learners have. Further, the limited scope of young learners’ experiences limits diversity as compared to experiences among adult learner s and the difference in experiences influences adult learning. One of the effects of experience that establishes its significance to adult learning is the realized need for specific knowledge among adults. Their interaction with real life phenomena such as in work environments identifies specific needs that motivates the adults into learning and the facilitator’s identification of the needs and capitalization on empowerment based on the needs forms a basis for further motivating adults in learning processes. Extensive experience that adults bring into learning also empowers them to contribute to learning processes and supports the assumption’s significance to learning processes of groups of adults because allowing the learners to be active
Friday, October 18, 2019
Lawrence v. Texas Essay Example | Topics and Well Written Essays - 1250 words
Lawrence v. Texas - Essay Example Many other reasons were given for declaring the statute illegal, but the second main issue for doing so was the fact that should the â€Å"deviant sex†be taking place between two consenting adults, and not involving minor children, public conduct, and/or prostitution, then it was not for the Court to â€Å"define the meaning of the relationship or to set its boundaries absent injury to a person or abuse of an institution the law protects†(6). The majority went on to say that, for the most part, adults could be trusted to enter into relationships of their own free will, as well as to consent to the type of sexual activity that would take place in them. Though this was a decidedly main issue, it can be said that it goes back to the first main issue, which was that adults, as adults, had a right to do what they wanted in their own homes, free from fear of punishment. Central to the majority opinion was a previous case, Bowers v. Hardwick, decided in the opposite manne r of Lawrence v. Texas. In Bowers v. Hardwick, the laws were upheld, and sodomy was declared to be an illegal act. The majority of Lawrence v. Texas declared that the reasoning behind the decision made to be flawed, as the Court did not â€Å"appreciate the extent of the liberty at stake†(6). What the Court failed to consider was that, again, the case was about consensual acts private to a relationship, again taking place in the privacy of a home, and not in public view. They also, again, did not involve minors. Therefore, according to the majority opinion.... Though this was a decidedly main issue, it can be said that it goes back to the first main issue, which was that adults, as adults, had a right to do what they wanted in their own homes, free from fear of punishment. Central to the majority opinion was a previous case, Bowers v. Hardwick, decided in the opposite manner of Lawrence v. Texas. In Bowers v. Hardwick, the laws were upheld, and sodomy was declared to be an illegal act. The majority of Lawrence v. Texas declared that the reasoning behind the decision made to be flawed, as the Court did not â€Å"appreciate the extent of the liberty at stake†(6). What the Court failed to consider was that, again, the case was about consensual acts private to a relationship, again taking place in the privacy of a home, and not in public view. They also, again, did not involve minors. Therefore, according to the majority opinion, Bowers v. Hardwick should not have been allowed to uphold the laws in the first place, as individual libert ies were being infringed upon. From the remarks made, it can be concluded that Lawrence v. Texas was simply correcting a wrong, and doing what Bowers v. Hardwick should have done in the first place, which was to declare sodomy the natural act of a relationship, and not something dirty and illegal. There were those on the Supreme Court that disagreed with the majority opinion, chief among them Justice Scalia and Justice Thomas. Their reasoning was separately made in their dissents, with Justice Scalia having the longer of the two. Justice Thomas kept it brief, mainly stating that while he concurred with the fact that the law was â€Å"uncommonly silly†as it was
Study Research Essay Example | Topics and Well Written Essays - 750 words
Study Research - Essay Example Mcmahon-Parkes et al. researched the outlooks and beliefs of patients who were resuscitated and those never resuscitated as well. Mcmahon-Parkes et al. argue that nurses always fear that family members may obstruct efforts to resuscitate their relatives (Mcmahon-Parkes et al., 2009). This fear is the key reason they do not tolerate them during resuscitate procedures. Nurses today also fear that family members who see their relatives undergo resuscitation processes might be harmed mentally. Mcmahon-Parkes et al justify this study by pointing out that there are no past qualitative literatures on the perceptions of nurses towards the company of families during the resuscitation of patients (Schmidt, 2010). In addition, few research works ever examined what patients preferred when it came to their families witnessing their resuscitation. Mcmahon-Parkes et al. explained the perspectives of patients who were revived successfully and patients taken to the ER but not requiring resuscitation (Mcmahon-Parkes et al., 2009). These perspectives examined whether both types of patients preferred their relatives present during resuscitation or not. The methodology used by Mcmahon-Parkes et al involved a sample of 21 revived patients and 40 patients taken to the ER. All patients were from 4 hospitals in two big cities in Southwest England. Mcmahon-Parkes et al. used a myriad of reviewers and uniform decision-making techniques (Schmidt, 2010). These methods proved effective for gathering perspectives from both types of patients regarding the company of their relatives during resuscitation. Findings showed that most patients preferred the company of their relatives while being resuscitated. Mcmahon-Parkes et al. discovered that both types of patients had three common themes in their preferences. The first theme was positive. Both types of patients understood that the company of their relatives meant that they were
Thursday, October 17, 2019
School Playgrounds Essay Example | Topics and Well Written Essays - 750 words
School Playgrounds - Essay Example The more dynamic modern play has more emphasis on adaptations and innovations. While encouraging inter-ethnic friendship and a vibrant oral culture, break time gives children the chance to explore the boundaries of their gendered experience within a safe conservative environment. Children ought to have the right to play and to choose what they play, which gives them a chance to put their dreams into action. The loss of play for fun has resulted to disillusionment and depression. The absence of challenge in the 'remodeled' playgrounds limits creativity, explorations, practice and fosters the development of attitudes that imply shying off from the face of challenges and taking risks. "It is through play that children explore their environment encountering numerous challenges to personal competence that involve decisions for risk-taking behavior" as argued by Jambor (1986). This freedom denial has not only resulted to the absence of fun but also risks the social health of the children. Break time is important for academic achievement, a more healthy development and maturity of peer relations and for general school adjustment. The reasons for limiting play and the increased adult supervision are inclined on affording more time for academic excellence, fears of developing negative peer relations and aggression by providing the children chances to exhibit antisocial behavior. (Pellegrini and Blatchford: 2002) The exposure to physical dangers while children play under trees, in tackling games, playing within school buildings, jumping off playground equipment or playing in wet areas must be controlled and guided. Conflicts and petty squabbles can arise, teasing and name calling, taunting and bullying and even violent incidents such as the murder of a British Asian boy in a Manchester Secondary School playground showing that violence, possibly racially motivated could erupt in playgrounds. Concerns also arise with students' behavior that could arise over the break and spill over into the school. (Blatchford: 1989) Break time has a positive 'educational value' in the sense that the longer children work on standardized tasks with no break the less attentive to the task they become and so breaks facilitate improved attention and focus on learning in the academic program (Pellegrini: 2005) This can be explained by the massed vs. distributed practice theory which explains that breaks inserted between periods of intense work help distribute effort and increase cognitive performances. (Bjorklund and Pellegrini: 2000). The playground at break time is the place where pupils interact on their own with minimal adult interference and they consider this time significant and enjoyable. Here, they play and meet friends in cooperative interaction involving governed games with their peers. Games are particularly important at the commencement of the school year when peers are not familiar with each other, but the knowledge of the rules of some common game forms the basis for interaction after which they become familiar which results to an interaction in the other domains. (Pellegrini and Blatchford: 2002) During recess periods, students learn to resolve conflicts, solve problems, negotiate, and work with others without adult intervention and also serves as a developmentally appropriate strategy for reducing
My Dream Vacation Essay Example | Topics and Well Written Essays - 250 words
My Dream Vacation - Essay Example If I have a lot of money and unlimited time, I would like to go on vacations to India. I have heard a lot about India, its unique culture, exotic natural beauty and cuisine, but have never been there. I want to visit India because she is so unlike my country i.e. the USA. People of India not only look different, they speak a different language and are entirely different from us Americans from every aspect. For one, I love the Indian race because of its facial features. I want to explore the diversity of India. From what I have read about India in the books and seen in the media, I have come to know that it is a land that unites people belonging to different subcultures. I particularly have a great taste for the Indian cinema. Although I don't understand Hindi or Urdu languages, yet they sound very sweet to the ears. The Indian cinematography is one of its kind. I love the heavily beaded dresses, their taste for heavy jewelry and makeup, and most importantly their respect for their ro les and responsibilities as members of a family. One thing that I could never understand about the Indian culture was how the Indians manage to live in the joint family system. Despite all the generational differences and gaps, they spend all their life together. This is something truly remarkable and worth-observing from a closer view, which is one of the main reasons I want to go to India for.
Wednesday, October 16, 2019
School Playgrounds Essay Example | Topics and Well Written Essays - 750 words
School Playgrounds - Essay Example The more dynamic modern play has more emphasis on adaptations and innovations. While encouraging inter-ethnic friendship and a vibrant oral culture, break time gives children the chance to explore the boundaries of their gendered experience within a safe conservative environment. Children ought to have the right to play and to choose what they play, which gives them a chance to put their dreams into action. The loss of play for fun has resulted to disillusionment and depression. The absence of challenge in the 'remodeled' playgrounds limits creativity, explorations, practice and fosters the development of attitudes that imply shying off from the face of challenges and taking risks. "It is through play that children explore their environment encountering numerous challenges to personal competence that involve decisions for risk-taking behavior" as argued by Jambor (1986). This freedom denial has not only resulted to the absence of fun but also risks the social health of the children. Break time is important for academic achievement, a more healthy development and maturity of peer relations and for general school adjustment. The reasons for limiting play and the increased adult supervision are inclined on affording more time for academic excellence, fears of developing negative peer relations and aggression by providing the children chances to exhibit antisocial behavior. (Pellegrini and Blatchford: 2002) The exposure to physical dangers while children play under trees, in tackling games, playing within school buildings, jumping off playground equipment or playing in wet areas must be controlled and guided. Conflicts and petty squabbles can arise, teasing and name calling, taunting and bullying and even violent incidents such as the murder of a British Asian boy in a Manchester Secondary School playground showing that violence, possibly racially motivated could erupt in playgrounds. Concerns also arise with students' behavior that could arise over the break and spill over into the school. (Blatchford: 1989) Break time has a positive 'educational value' in the sense that the longer children work on standardized tasks with no break the less attentive to the task they become and so breaks facilitate improved attention and focus on learning in the academic program (Pellegrini: 2005) This can be explained by the massed vs. distributed practice theory which explains that breaks inserted between periods of intense work help distribute effort and increase cognitive performances. (Bjorklund and Pellegrini: 2000). The playground at break time is the place where pupils interact on their own with minimal adult interference and they consider this time significant and enjoyable. Here, they play and meet friends in cooperative interaction involving governed games with their peers. Games are particularly important at the commencement of the school year when peers are not familiar with each other, but the knowledge of the rules of some common game forms the basis for interaction after which they become familiar which results to an interaction in the other domains. (Pellegrini and Blatchford: 2002) During recess periods, students learn to resolve conflicts, solve problems, negotiate, and work with others without adult intervention and also serves as a developmentally appropriate strategy for reducing
Tuesday, October 15, 2019
A Life That Almost Happened Lab Report Example | Topics and Well Written Essays - 1250 words
A Life That Almost Happened - Lab Report Example It listed jobs in food service, supermarket cashier, but the mere fact that he had a resume at all is evidence that he had set goals and ambitions. It tells the story of potential- the story of a life that almost happened. After graduating from North High School in 1999, Alfonso moved out of his mother's house in the government project where he grew up, instead, he went to work, driving a delivery truck for Albuquerque Tortilla. Even then he wanted to be more than a delivery boy. For a while, Alfonso had considered going into the Marine Corps, but decided instead to go to college once he paid off his truck. In the meantime, he moved in with his sister, Miriam Celaya, and her two children. On Saturday afternoon, March 10th 2001 Alfonso had gone to his friend Rafael Espinoza's house at 31st Avenue and Washington Street. Rafa was 20 then with three kids, twins on the way, a wife and a girlfriend on the side. He said that he's not a bad guy and that he's stayed away from gangs and drugs. But Alfonso's family isn't convinced, either, so on that Saturday Alfonso has to go to Rafa's house, because Miriam doesn't approve of the friendship and doesn't want Rafa in her home. Late that afternoon, Alfonso and another friend, Narvel Murrieta, headed towards Rafa's house in Alfonso's white pickup. Narvel had arrived in Phoenix less than two weeks ago from a small ranching community called Pantanito, in Magdalena, Sonora, where Alfonso's family also has a home. Alfonso has offered to show Narvel around, and help Narvel get acquainted with life in Phoenix. They arrived at Rafa's small gray house around 4:30. Then the three men talked outside for a while about their plans for the evening. Narvel has never been out in Phoenix, and wants Alfonso to show him around. Today was also Rafa's girlfriend's 21st birthday. The trio makes tentative plans to meet up later in the evening to celebrate. Then they headed to the nearby house of Rafa's cousin, where Rafa plays the accordion, while the cousin gives Alfonso a guitar lesson. Then Alfonso and Narvel leave for their house while Rafa called his girlfriend Estrella, to make plans to celebrate her birthday. While at the same time, not far from Rafa's house, 18-year-old Jesus Maris pumps gas at the Texaco, a black man selling jewelry, a watch, some bracelets, chains and a semi-automatic handgun approached him. The man wanted $100 for the gun, but Jesus talked him down to $40. He hoped to sell the gun for $100 himself and make some money. Jesus heads home around 6 p.m. and gets ready to go out for the evening. Jesus would later tell investigators, that the purchase of the gun was more a product of chance and opportunity than anything else. As dinnertime approached at the Celaya house, the family sent Noel Caudillo, one of the brothers to get hamburgers from Carl's Jr. hamburgers. After dinner, Narvel and Alfonso left together, and didn't tell the family where they're headed. It was the last time Alfonso's mother would see her youngest son alive. Around the same time, Jesus Maris, Omar Mendez and his brother Antonio had just finished drinking a couple of beers at Omar's apartment in Mesa. They headed to a party. There, they met up with another friend and had a few more drinks. About a half-hour later, the four cruise toward Phoenix in a Chevy pickup. While Alfonso and Narvel, Estrella and her two friends, and Rafa's 15-year-old sister all arrived at Rafa's house. They got into two cars, heading out for an evening at the Mexican
International Language Essay Example for Free
International Language Essay Across 294 countries in the world, there are about 6,500 languages are commonly using in the daily life. The domination of English has been proved as an international language all across with the coming of globalization in future, English is the language of diplomacy and international communications for the use of business, tourism, education, science, computer technology, media, Internet and etc. Without language, all the things couldn’t happen and stay in place like today. People nowadays who stand in the marketplace ordinarily using English as an international language for the purpose of fulfilling communicative needs, a common language to facilitate trade and communication seems unavoidable. Some people think that globalization will become a big threat to the national, cultural and even religious identities as using only a single language and ultimatum to the development of a country. Posses single language may lead to cultural corrosion, a loss of local linguistic knowledge, and mainly will cause to losing of own language which is the carrier of all their cultural values identity is the first thought of conservative minded while they firstly expose to the word of globalization. However, in my opinion, it is possible to use an official international language and still retain theirs own languages with their own cultures values identity. I presented to support that having a single language as an international official language not only provides the opportunities for social mobility and modernity but also removes the probability of losing the national language the carrier of identity by helping people to be identified to the whole world as they are given voices. It is getting involved in international interactions and communications is required. Therefore, to be an active participant in globalized relations, it is necessary to adopt the international language. Using an international language provides opportunities for people to make contributions to the formation and development of that language to lead to scientific and cultural independence. Language is only the instrument of communication for people around the world. Many countries had been adapted to the cultural with an official language or languages. In any country where there are innumerable languages spoken, there is a need for official languages to ensure the flow of communication between different sections of the population and the different states. Above all, international language is important as a common language for people, without language, there will be absence of interaction between people, while there will be a link occurred to no communication to no trading and etc. It’s also important in every aspect for the world. Nowadays, English is considered the universal language for business, international communications, entertainment, tourism, trade and technology. The majority of all resources on the internet are all in English, affecting people to learn English to take full advantage of it. More important, learning English is significant for human to being able for information exchange and connecting to others. In the prevalent globalization there is no doubt that an international language is unavoidability. While trading a business, language is playing an important role of people, if human found difficult in the activation of a common in language spoken, they cannot trade in business. In this sense, not only is an international language inevitable, but also a necessary for trading, commerce and economic expansion by the turn of the century. The criticism to opposing the using of an international official language contends that it would lead to cultural corrosion and a loss of cultural values identity. However, the use of an international official language does not mean that their local languages will disappear. If English already functions as a kind of unofficial international language but this doesn’t mean that people only converse in using English or they ignore their own languages. English is used in specific contexts such as trade, business, etc. and native languages are used for everyday instruction.
Monday, October 14, 2019
Genetic Variation of Taste Receptors
Genetic Variation of Taste Receptors Abstract: The people have different behaviour to choose the food, and there are many factors that affect the food choices. The best significant factor to choose the food is taste. Differences in taste perception of several taste modalities are associated to difference in the taste receptors. Polymorphisms of the genes that encoding these taste receptors may clarify these unpredictability in taste perception. Individual changes in the capability to identify bitter tasting compounds, such as phenylthiocarbamide (PTC) was a well-known example of this variability. This difference divided the people in two groups: tasters and non-tasters, and is because of in part to single nucleotide polymorphisms (SNP) of a bitter taste receptor gene, taste receptor, type 2 (TAS2R) 38. The experiment was designed to determine the PTC phenotype and genotype, the SNP at position 785 is of particular importance in genotyping. DNA was extracted from check cell by using Chelex technique and genotyped by using polymera se chain reaction (PCR) followed by restriction fragments length polymorphism (PCR-RFLP). A 2% of Agarose gel electrophoresed and stained with Ethidium Bromide to imagine the genotype pattern. The class was tasted PTC test paper to compare phenotype and genotype. The total was 108 students the genotype showed 21 taster (+/+), 51 was mild taster (+/-) and 36 was nontaster (-/-). The allele frequency was not statistically significantly differ from European population. Therefore, TAS2R38 genotype is a truer estimation of the extent of the influence of this single gene on taste perception of PTC in a genetically diverse population. Introduction: Taste perception is the most sensitive predictor of how much a food is pleasant and unpleasant. The people are different in the taste perception of sweet, bitter, sour, or salty tastes which could influence the dietary behaviour (2, 3, 4). The variations in the taste perception between the individuals may relate to a variation in the gene taste receptors (2). The gene family of the taste receptors are encoding from TAS1R and TAS2R. The bitter taste receptors are include the TAS2R38 and TAS2R550. While the umami and sweet taste receptors is the TAS1R. The sour taste receptors are the PKDIL3 and PKD2L1. The genetic variation in these receptors may causes to deferential favourites for some types of food. Phenylthiocarbamide (PTC) compounds is the example was more studied in the variation of the sensitivity of taste as the bitterness (2, 5). The TAS2R38 gene is one of the most studied from over twenty-five in bitter taste receptor gene (4).The TAS2R38 gene is responsible for the taste perception of PTC as more bitter and the other related compounds like 6-n-propylthiouracil (PROP) which both contain a group of thiourea (7.8). The variation in the gene TAS2R38 divided the individuals in two groups of thiourea tasters: tasters and non-tasters (4, 5). Phenylthiocarbamide (PTC) The variation in the taste perception of PTC rely on the genetic studies. In 1930s, difference in the ability to taste PTC was first finding by Arthur L. Fox in a laboratory accidental (6). When he was working in the laboratory and transferring PTC powder into a bottle. Some particles of PTC powder flew into the air and his colleague close to him C. R. Noller tasted the particles as bitter but Fox tasted nothing. Fox was make experiment to test a large number of individuals and he found the difference in their ability to taste PTC and he divided the people in two main groups’ tasters and non-tasters (1). Worldwide about 25% of population classified as ‘non-tasters’ and the remaining 75% as ‘tasters’ (1). In addition, Bartoshuk et al, in 1992, discovered that the ‘tasters’ varied in the perception of PTC/PROP in a bi-modal fashion, and they separated them into medium tasters and supertasters. The supertasters were very sensitive to PTC, pe rceiving them as more bitter, while the medium tasters may taste PTC and found it mild bitter. Besides, the spread of super, medium and non-tasters in the general population is roughly 25%, 50% and 25%, respectively (1). The PTC sensitivity believed to be inherited as a simple Mendelian trait with two alleles a dominant trait (T) for taster and recessive trait (t) for non-taster (9). Figure 1: shows the inheritance of PTC trait. PTC genotype TAS2R38 or PTC gene is located on chromosome 7q and consists of a single coding exon 1002 bp long, encoding 333 amino acids, 7-transmembrane domain G-protein-coupled receptor (2, 6). A number of SNPs have been identified within this gene, the three most common SNPs (>1% of the population has variants at a specific DNA sequence, considered an SNP and (4).Also, the PAV/PAV homozygotes are sensitive to PTC more than PAV/AVI heterozygotes while AVI/AVI homozygotes are fewer sensitive (4). The AVI haplotypes in the non-tester differ at 3 SNPs from the PAV haplotypes of the tasters (9). The aim of this practical: To focus on the TAS2R38 genotype and its link with the ability to taste PTC test paper. The SNP at position 785 is of specific concern in genotyping. Comparing the allele frequency detected in the class with those observed in European population subject in group 226 and Sub-Saharan African subject in group 224. Material and Methods: To determine the TAS2R38 (A262V) genotype by using the polymerase chain reaction (PCR) and restriction endonuclease digestion, Fnu4H1 enzyme. The procedure that has been done was as the following: Protocol of DNA Extraction from Cheek Cell (scrape or wash): First week take a 10 ml of water pour into mouth and swirl to release buccal cells and spit back contents into tube. Centrifuge the tube at 3000rpm for 3 minutes, carefully pour off supernatant and retain cell pellet. Added 350Â µl of 5% Chelex mix and then transfer the pelleted buccal cells to new (1.5ml) Eppendorf tube. The 5% Chelex to protects DNA breakdown under a high temperature. Added 4Â µl of proteinase K to the Eppendorf tube that contains buccal cells and 5% Chelex. Incubated the tube containing chelex/cells at 56Â °C for 30 minutes in the heating block, then briefly vortex the tube for 10 seconds after that centrifuge the tube at 3000rpm for 20 seconds. Incubated the tube ( chelex/cells) again in heating block at 98Â °C for 15 minutes, then vortex the tube for 10 seconds, after that centrifuge for 3minutes.Transferred the supernatant that above the chelex containing the buccal cell (DNA template) into the sterile 1.5ml Eppendorf tube and measured the DNA concentration by take 1Â µl of DNA into machine called nanodrop nucleic acid then kept at -20Â °C to preserve the DNA. Protocol of Phenyl Thiocarbanate(PTC) using PCR Reaction: Second week take a 43.5Â µl of master mix was already prepared in the PCR tube and transferred 6.5Â µl of DNA extraction. (Buccal cell DNA).Vortex and spin the tube to make the liquid contents to bottom of the tube. The total PCR tube reaction volume contain 50Â µl of mixtures were placed in the PCR machine and the thermal cycler conditions were: cycle of 94Â °C for 4 minutes. The 40 cycles of 55Â °C for 40 seconds, 72Â °C for 40 seconds and 94Â °C for 40 seconds .Then 1 cycle of 55Â °C for 5 minutes and at 72Â °C for 5 minutes. The sequence of Forward primer was 5’ AACTGGCAGAATAAAGATCTCAATTTAT3’ The sequence of the Reverse primer was 5’ AACACAAACCATCACCCCTATTTT 3’. Restriction Digestion (Fnu4HI): Last week transferred a 20 ÃŽ ¼l of the component mixture (PCR product) to a tube containing 10ÃŽ ¼l of the restriction endonuclease master. The tube was placed in into a 37Â °C heating block for two hours. Electrophoresis of PCR Products: A 30ml of 2% Agarose gel with 0.5Â µl/ml of ethidium bromide was loaded into the gel tank with adjusting the comb, the gel was kept 15 minutes to get stuck. After that the TBE buffer was loaded, covering the surface of the gel and the comb was removed. Take 12Â µl of PCR product undigested and digested into two different tubes added 3Â µl of DNA loading buffer mix and spin. Then, 10ÃŽ ¼l of PCR product/loading buffer was loaded into the well of 2% Agarose gel and 10ÃŽ ¼l of the ladder (100bp) was added in the last well. The gel electrophoresed at 90 volt for 45minutes, negatively charged (-ve) DNA moved toward the anode side (red). Last take gel photograph under UV trans-illumination. Taste tests: The PTC taste test paper was used to observe the capability to identify the bitterness of PTC and its relative with the TAS2R38 genotype. Statistical analysis: The data of the allele frequency for C785 and T785 observed in the class was compared to the allele frequency of European population subjects in group 226 and Sub-Saharan African subject in group 224 by using the Chi square test. The Chi square test was also used to investigate the association between the TAS2R38 genotype and phenotype. All statistical analyses were performed with Minitab data analysis software. References Feeney E. The impact of bitter perception and genotypic variation of TAS2R38 on food choice. Nutrition Bulletin. 2011; 36(1):20-33. Wooding S, Kim U, Bamshad M, Larsen J, Jorde L, Drayna D. Natural Selection and Molecular Evolution in PTC, a Bitter-Taste Receptor Gene. The American Journal of Human Genetics. 2004; 74(4):637-646. Chaudhari N, Roper S. The cell biology of taste. The Journal of Cell Biology. 2010; 191(2):429-429. Feeney E, OBrien S, Scannell A, Markey A, Gibney E. Genetic variation in taste perception: does it have a role in healthy eating? Proc Nutr Soc. 2010; 70(01):135-143. Lalueza-Fox C, Gigli E, de la Rasilla M, Fortea J, Rosas A. Bitter taste perception in Neanderthals through the analysis of the TAS2R38 gene. Biology Letters. 2009; 5(6):809-811. Kim U, Drayna D. Genetics of individual differences in bitter taste perception: lessons from the PTC gene. Clinical Genetics. 2004; 67(4):275-280. Dotson C, Shaw H, Mitchell B, Munger S, Steinle N. Variation in the gene TAS2R38 is associated with the eating behavior disinhibition in Old Order Amish women. Appetite. 2010; 54(1):93-99. Duffy V, Davidson A, Kidd J, Kidd K, Speed W, Pakstis A et al. Bitter Receptor Gene (TAS2R38), 6-n-Propylthiouracil (PROP) Bitterness and Alcohol Intake. Alcoholism: Clinical Experimental Research. 2004; 28(11):1629-1637. Merritt R, Bierwert L, Slatko B, Weiner M, Ingram J, Sciarra K et al. Tasting Phenylthiocarbamide (PTC): A New Integrative Genetics Lab with an Old Flavor. The American Biology Teacher. 2008; 70(5):e23-e28. Appendix
Sunday, October 13, 2019
Human Values and Ethics - What Science Cannot Discover, Mankind Cannot Know :: Philosophy Essays
Human Valuse and Ethics - What Science Cannot Discover, Mankind Cannot Know Those who maintain the insufficiency of science, as we have seen in the last two chapters, appeal to the fact that science has nothing to say about "values." This I admit; but when it is inferred that ethics contains truths which cannot be proved or disproved by science, I disagree. The matter is one on which it is not altogether easy to think clearly, and my own views on it are quite different from what they were thirty years ago. But it is necessary to be clear about it if we are to appraise such arguments as those in support of Cosmic Purpose. As there is no consensus of opinion about ethics, it must be understood that what follows is my personal belief, not the dictum of science. The study of ethics, traditionally, consists of two parts, one concerned with moral rules, the other with what is good on its own account. Rules of conduct, many of which have a ritual origin, play a great part in the lives of savages and primitive peoples. It is forbidden to eat out of the chief's dish, or to seethe the kid in its mother's milk; it is commanded to offer sacrifices to the gods, which, at a certain stage of development, are thought most acceptable if they are human beings. Other moral rules, such as the prohibition of murder and theft, have a more obvious social utility, and survive the decay of the primitive theological systems with which they were originally associated. But as men grow more reflective there is a tendency to lay less stress on rules and more on states of mind. This comes from two sources - philosophy and mystical religion. We are all familiar with passages in the prophets and the gospels, in which purity of heart is set above meticulous observance of the Law; and St. Paul's famous praise of charity, or love, teaches the same principle. The same thing will be found in all great mystics, Christian and non-Christian: what they values is a state of mind, out of which, as they hold, right conduct must ensue; rules seem to them external, and insufficiently adaptable to circumstances. One of the ways in which the need of appealing to external rules of conduct has been avoided has been the belief in "conscience," which has been especially important in Protestant ethics.
Saturday, October 12, 2019
Telecommuting and Human Resources Essay -- GCSE Business Marketing Cou
Telecommuting and Human Resources Introduction On September 20, 1994, some 32,000 AT&T employees stayed home. They weren’t sick or on strike. They were telecommuting. Employees ranging from the CEO to phone operators were part of an experiment that involved 100,000 people. It’s purpose? To explore how far a vast organization could go in transforming the workplace by moving the work to the worker instead of the worker to work. Today AT&T is just one of many organizations pioneering the alternative workplace (AW-also known as telecommuting) – the combination of nontraditional work practices, settings, and locations that is beginning to supplement traditional offices (Apgar, 121). According to IDC/Link Resources, New York, approximately 8 million Americans currently telecommute. A survey conducted by Olsten Corp., Melville, N.Y., reports that 62 percent of North American companies encourage telecommuting (Riggs, 46). In addition, research shows about 50% of all employees either have a job that lends itself to telecommuting or want to get involved in telecommuting. Most researchers agree that telecommuting growth is fastest in companies employing more than 1,000 and in those with under 10 employees (Harler, 26). Current Situation Telecommuting came into existence out of necessity. First, increasing global competition has brought pressures and opportunities to businesses, consultants, and service vendors. As a result, the Yankee Group predicts that as many as 80 percent of all employers will have to adopt remote work in order to compete in world markets by mid-to late nineties (Manire, 51). Second, the Information Age necessitates that companies move faster and thus act and react to business conditions sooner. Third, telecommuting has been increasingly enforced at state and federal levels due to the Clean Air Act (CAA) of 1970, as amended in 1990. The CAA affects any firm with over 100 employees in areas with â€Å"severe ozone attainment levels†, which covers every good-sized city in the nation (Harler, 27). The Impact of the Internet on Telecommuting The Internet is widely becoming part of the plan when implementing and integrating telecommuting solutions. The Internet can add a powerful dimension to the management of both internal and external information functions and strengthen the organization’s human resource management informa... ...ivity remains an objective for management as we approach 2000. But we realize today that significant gains in productivity may not be achieved not through division of labor but by creating mechanisms for people to communicate more effectively and to manage information more efficiently. Bibliography: Apgar IV, Mahlon. (May/Jun 1998). â€Å"The alternative workplace: Changing where and how people work†, Harvard Business Review, pp-121-130. Berhard, Frank. (March 15, 1998). â€Å"Upside economics of telecommuting†, America’s Network, pp20-23. Harler, Curt. (March 15, 1998). â€Å"The good, the bad and the fattening†, America’s Network, pp26-28. Hein, Kenneth. (May 1997). â€Å"Virtually always at work†, Incentive, p9. Kuzmits, Frank and Santos, Brian. (Spring 1997). â€Å"The Internet: A key tool for today’s human resource professional†, S.A.M Advanced Management Journal, pp33-39. Manire, Ross W. (January 1997). â€Å"Remote access: The â€Å"drive to work†in the information age†, Telecommunications, pp50-55. Riggs, Lynn. (June 1997). â€Å"New approaches to management†, Credit Union Management, pp46-48. Thompson, Courtenay. (October 1998). â€Å"Telecommuting exposures†, The Internal Auditor, p67.
Friday, October 11, 2019
The Indigo Spell Chapter Seventeen
ALTHOUGH OUR MAGICAL PLANS had been derailed, Ms. Terwilliger had asked me to come by her room before classes started in the morning so that we could talk strategy and future assignments. I had just enough time to swing by the cafeteria for breakfast and found Jill, Eddie, and Angeline sitting together. It felt like it had been a long time since we'd all been together in some kind of normal setting, and I welcomed this small moment of bonding. It was a refuge in the storm that had been my life recently. Jill was grinning about something that Eddie didn't seem to find so funny. â€Å"He didn't say anything about it to me,†he said. â€Å"Of course not.†Jill laughed. â€Å"He's too embarrassed.†I sat down with my tray. â€Å"Who's too embarrassed?†I assumed any â€Å"he†they were talking about must be Adrian, though it was hard to imagine Adrian embarrassed about anything. â€Å"Micah,†said Jill. â€Å"I talked him into modeling for our sewing club again. And then he got Juan and Travis to do it too. â€Å" â€Å"How'd you manage that?†I asked. Jill had originally gotten involved with Lia through the school's sewing club. Back when Jill and Micah had dated, she'd convinced him to model some very badly made clothes. He'd done it out of adoration, though I wasn't sure he'd really enjoyed it. Jill leaned forward, an excited sparkle in her eyes. â€Å"Claire guilted him into it! It was hilarious. But I don't know how he talked Juan and Travis into it. Maybe they owed him a favor.†â€Å"Maybe they have ulterior motives,†said Eddie. His tone surprised me until I remembered his lesson about the latest social developments around here. What was it? Claire was Micah's new girlfriend. Juan and Travis were his friends, who liked Jill. Eddie didn't like that they liked her. Got it. Apparently, Eddie hadn't kept his opinions to himself because Jill rolled her eyes. â€Å"Will you stop worrying about that?†she asked. She was still smiling but sounded just a little annoyed. â€Å"They're good guys. And I'm not going to do anything stupid. You don't have to lecture me about humans and Moroi. I get it.†Her jade eyes flicked over to me, and her smile faltered a little. She studied me for several long, troubled moments, and I wondered what she was thinking about. Was she still hoping for some romantic resolution between Adrian and me? Was she wondering why Adrian and I kept getting into intimate situations? I kind of wanted to know that too. She finally dragged her gaze away, letting her happy mood return. â€Å"I'm just looking out for you,†Eddie said obstinately. â€Å"You look out for assassins. I can handle these guys. I'm not a child, and besides, these are the most male models we've ever had. It's great. If we could score a couple more, our club could do a whole project on men's clothing.†Eddie still looked way too serious for this discussion. â€Å"Maybe Eddie would volunteer,†I suggested. â€Å"I bet guardian posture would be great on the catwalk.†He blushed, which even I had to admit was adorable. If Jill had been irritated by his earlier overprotectiveness, it was no longer obvious. From her dreamy expression, you'd think Eddie blushing was the most amazing thing she'd ever witnessed. I think he was too overwhelmed at the thought of strutting down a runway to notice. Angeline had been completely silent so far. I glanced over at her, expecting her to have something funny to say about her boyfriend being encouraged to model. But to my surprise, she wasn't paying attention to the conversation at all. She had a geometry book open and was furiously trying to draw some circles freehand. It killed me to watch, but after Kristin's comment about Angeline stabbing someone with a compass, freehand might be best. â€Å"What do you think, Angeline?†I asked, just to see how engrossed she was. â€Å"Do you think Eddie would make a good model?†â€Å"Hmm?†She didn't look up. â€Å"Oh, yeah. You should let Jill try some clothes on you.†Now Jill blushed. Eddie's deepened. Just when I thought this meal couldn't get any more surreal, Trey stopped by. He nudged Angeline's chair with his toe. â€Å"Hey, McCormick.†He nodded toward her graph paper. â€Å"Time to check out your curves.†Rather than answering with some biting response, she looked up instantly, a big smile on her face. â€Å"I've been working on them all morning,†she said. â€Å"I think they're pretty good.†â€Å"They look good from where I'm standing,†said Trey. They were actually the worst circles I'd ever seen, but I guessed Trey wanted to encourage her. I was amazed at how seriously she was treating this math grade. It seemed to me that she was putting it above everything else, even her personal life. She gathered up all her things so that she and Trey could go to the library. Eddie looked disappointed but couldn't protest, lest it give away the truth about Angeline and him. Trey knew we weren't all actually related, but Eddie and Angeline's relationship was still kept secret. I realized then that it was almost time to meet Ms. Terwilliger. I hurriedly finished a banana and told Eddie and Jill I'd see them later. Whether they would talk about male modeling or Jill's dating life, I couldn't guess. I showed up right on the dot for my meeting but found Ms. Terwilliger's room locked and dark. Even in crisis mode, I supposed she was entitled to run a little late now and then, so I settled down on the hallway floor and read ahead for my English class. I grew so absorbed that I didn't realize how much time had passed until I heard the warning bell ring and realized students were starting to fill the halls. I glanced up just as the same harried substitute teacher from before came scurrying up to the door with a set of keys. I scrambled to my feet. â€Å"Ms. Terwilliger's out today?†I asked. â€Å"Is she okay?†â€Å"They don't tell me the reasons,†the sub said brusquely. â€Å"They just ask me to be here. I hope she left an assignment this time.†Knowing Ms. Terwilliger, I had a feeling it was going to be another â€Å"homework†day. I shuffled into the classroom after the sub, feeling a knot of anxiety in my stomach. The next hour was agonizing. I barely heard as the sub told us to work on homework. Instead, I kept sneaking glances at my cell phone, hoping a text would come from Ms. Terwilliger. No such luck. I went from class to class but was too distracted to give anything my full attention. I even shocked myself in English when I nearly mixed up Henry IV with Henry VI while answering an essay question. Thankfully, I caught myself before committing that embarrassing mistake to paper. When I returned to Ms. Terwilliger's classroom for my independent study at the day's end, I was expecting the sub to tell me I could leave early again. Instead, I found Ms. Terwilliger herself, rifling through papers on her desk. â€Å"You're back!†I exclaimed. â€Å"I thought something had happened to you.†â€Å"Not me,†she said. Her face was pale and drawn. â€Å"But someone else wasn't so lucky.†â€Å"No. Not again.†I sank into a chair, and all the fears I'd been carrying around today came crashing down on me. â€Å"I'd hoped we'd protected those girls.†Ms. Terwilliger sat down opposite me. â€Å"It wasn't one of them. Last night, Veronica targeted one of my coven members. Alana.†It took me several moments to truly process that. â€Å"Your coven . . . you mean, like a full-fledged witch?†â€Å"Yes.†â€Å"Someone like you?†Her face gave me the answer before she spoke. â€Å"Yes.†I was reeling. â€Å"But you said she only went after young girls.†â€Å"Normally she does. That way she can capture youth and beauty along with power.†Ms. Terwilliger didn't look like she had to worry about someone stealing her youth anytime soon. Fatigue and stress were taking their toll on her, making her look older than she was. â€Å"Now, some magic users who perform this spell are only concerned about power, not getting younger. That's never been Veronica's style, though. She's vain. She always wanted the superficial benefits – not to mention easier victims. Someone like my coven sister would be more difficult to take, so this is surprising behavior.†â€Å"It means you could be a target,†I said. â€Å"You've been saying all this time that you're safe, but now everything's different.†Ms. Terwilliger shook her head, and a bit of steely resolve flashed in her eyes. â€Å"No. Maybe she did this to throw me off, to make me think it's someone else behind the spells. Or maybe to make me think she's not interested in you. Whatever the reason, she won't target me.†I admired Ms. Terwilliger for thinking so well of her sister, but I couldn't share her confidence that sisterly affection would overcome an evil quest for youth and power. â€Å"No offense, ma'am, but isn't there a slight chance you could be wrong about her coming for you? You said she'd only go after young novices, but obviously, that's not the case. She's already doing things you didn't expect.†Ms. Terwilliger refused to back down. â€Å"Veronica may do any number of terrible things, but she won't face me unless she's absolutely forced to.†She handed over a new spell book and a small drawstring bag. â€Å"Just because she went after an older witch, it doesn't mean you're out of danger. I've marked some pages I want you to go over. There's a spell there I think will prove particularly useful. I've gathered some components for you, and you should be able to cast the rest yourself – just make sure you do it somewhere remote. Meanwhile, I still need to make you that secondary charm. There's just so much to do lately.†A mix of emotions swirled within me. Once again, I was amazed that Ms. Terwilliger would go to such lengths for me. Yet I couldn't shake my fear for her. â€Å"Maybe you should make one for yourself, just in case.†She gave me a wan smile. â€Å"Still pushing that, hmm? Well, once I've secured yours, I'll see about another. It may take a while, however. What I have in mind for you is particularly complex.†That made me feel even worse. She always looked so worn out lately, and all these things she was doing for me were only intensifying the situation. But no matter how many arguments I made, she refused to listen. I left her classroom feeling upset and confused. I needed to vent to someone. Obviously, my choices were limited in this matter. I texted Adrian: V attacked a real witch last night. Ms. T won't protect herself. She's only worried about me. As usual, I received a quick response: Wanna talk about it? Did I? I wasn't the type to sit and analyze my feelings, but I did actually want company. I knew I shouldn't spend more time around Adrian than I had to when my feelings for him were already so mixed. But he was the only person I wanted to talk to. I have to cast some spells for her now. Want to pick me up and come along? My answer was a smiley face. She'd told me to go somewhere remote, so I picked Lone Rock Park again. When Adrian and I arrived, it was smoldering in the late-afternoon heat, and I found it hard to believe Christmas was only a couple weeks away. I'd dressed in layers, just like before, and took off my Amberwood hoodie as Adrian and I trekked across the rocky terrain. He took off a coat as well, and I had to do a double take when I saw what he was wearing underneath. â€Å"Really?†I asked. â€Å"Your AYE shirt?†He shot me a grin. â€Å"Hey, it's a perfectly good shirt. I think I'm going to see if I can start a chapter on Carlton's campus.†Carlton was the college he took art classes at. It was pretty small and didn't even have fraternities or sororities. â€Å"A chapter?†I scoffed. â€Å"Don't you mean the only chapter?†â€Å"Gotta start somewhere, Sage.†We reached the same spot where I'd practiced with Ms. Terwilliger, and I tried to ignore the scorch marks on the ground. Adrian had decided to turn this into a desert picnic and had brought along a basket containing a blanket and a thermos of lemonade. â€Å"I figured we could stop at Pies and Stuff on the way back since I know how much you like that place,†he explained, deadpan, as he poured me a cup. â€Å"Hopefully this'll tide you over after the spell.†â€Å"I wish this was over,†I said, running my hand over the weathered leather of Ms. Terwilliger's latest book. It was an old handwritten one called Summonings and Conjurations. â€Å"I hate living with the uncertainty, worrying that Veronica's lurking behind every corner. My life's already complicated enough without witches coming after me.†Adrian, face serious, stretched out on the blanket and propped his head up with his elbow. â€Å"If she's even coming after you.†I sat down cross-legged, careful to keep a lot more distance than in the Velvet Suite. â€Å"Ms. Terwilliger won't listen to me. She just keeps stressing over me.†â€Å"Let her,†he suggested. â€Å"I mean, I totally get why you're worried about her. I am too. But we have to accept that she knows what she's talking about. She's been involved with this stuff a lot longer than we have.†I couldn't help but smile at that. â€Å"Since when are you involved with magic?†â€Å"Since I started looking after you and being all manly and brave.†â€Å"Funny, I don't remember it that way.†I worked to keep a straight face. â€Å"If you think about all the rides I gave you, me getting you into college . . . well, it kind of seems like I'm looking after you.†He leaned toward me. â€Å"I guess we look after each other.†We locked eyes and smiled, but there was nothing sensuous about it. There was no trick here, no sly move on Adrian's part to advance on me. And there was no fear on my part. We were just two people who cared about each other. It reminded me of what had initially drawn us together – before all the romantic complications. We connected. Against all reason, we understood each other, and – as he said – we looked out for each other. I'd never had a relationship quite like that with anyone and was surprised at how much I valued it. â€Å"Well, then, I guess I'd better get to work.†I glanced back down at the book. â€Å"I haven't had a chance to look at what she wants me to do. It doesn't sound like a defensive book.†â€Å"Maybe you're graduating from fireballs to lightning bolts,†Adrian suggested. â€Å"I bet it'd be a lot like throwing ninja stars. Except, well, you could incinerate people.†When I found the page Ms. Terwilliger had marked, I read the title aloud: â€Å"Callistana Summoning.†â€Å"What's callistana mean?†asked Adrian. I scrutinized the word, making sure I was deciphering the elaborate script correctly. â€Å"I don't know. It's kind of like the Greek word for ‘beautiful,' but not quite. The spell's subtitle is ‘For protection and advanced warning.'†â€Å"Maybe it's some kind of shield, like the one Jackie had,†suggested Adrian. â€Å"An easier one.†â€Å"Maybe,†I agreed. I wouldn't mind a little bit of invulnerability. I opened up the bag Ms. Terwilliger had given me. Inside, I found dragon's blood resin, a small bottle of gardenia oil, branches of juniper berries, and a glittering smoky quartz crystal, rutilated with lines of gold. Although she'd provided the ingredients, the spell's directions required that I use and measure them in a very specific way, which made sense. As usual, it was the caster's work that powered the magic. Adrian sat up and read over my shoulder. â€Å"It doesn't really say what happens when you cast it,†he pointed out. â€Å"Yeah . . . I'm not really excited about that part.†Presumably, the caster was supposed to just know what she was doing. If this was some kind of protective shield, then maybe the shield would materialize around me, just as it had for Ms. Terwilliger. â€Å"Well, no point in wasting time. We'll find out soon enough.†Adrian chuckled as he watched me walk over to a clear piece of land. â€Å"Am I the only one amazed that you now perform magic blindly?†â€Å"No,†I assured him. â€Å"You're not the only one.†I had to pluck the juniper berries off one by one and make a small ring with them, saying, â€Å"Fire and smoke,†each time I placed one on the ground. When I finished, I anointed each berry with a drop of the oil and recited, â€Å"Breath and life.†Inside the circle, I lit a small pile of the resin and rested the smoky quartz on top of it. Then I stepped back and reread the spell, committing the words and gestures to memory. Once I was satisfied I knew it, I handed it to Adrian and shot him a hopeful look. â€Å"Wish me luck,†I said. â€Å"You make your own luck,†he replied. I tried not to roll my eyes and turned toward the circle. I recited the spell's complex Greek incantation, pointing in the four cardinal directions as I spoke, per the book's instructions. It was startling how quickly the magic welled up within me, filling me with that blissful power. I spoke the last words, pointing at the juniper circle as I did. I felt the magic pour from me and into the quartz. Then I waited for something to happen. Nothing did. I looked back at Adrian, hoping he noticed something I hadn't. He shrugged. â€Å"Maybe you did it wrong.†â€Å"It worked,†I insisted. â€Å"I felt the magic.†â€Å"Maybe you just can't see it. At the expense of getting myself in trouble here, you should know how amazing you look when you do that stuff. All graceful and – †His eyes went wide. â€Å"Um, Sydney? That rock is smoking.†I glanced back at the circle. â€Å"That's just the resin that's – â€Å" I stopped. He was right. Smoke was coming out of the quartz. I watched, fascinated, and then slowly, the quartz began to melt. Rather than dissipate into a puddle, though, the liquid began to re-form into a different shape, one that soon hardened into something new and unexpected: a crystalline dragon. It was small, able to fit in a palm, and glittered just like the dark brown quartz had. The dragon looked more like the serpentine kind usually associated with Chinese culture rather than the winged types of European myth. Every detail was meticulously carved, from the tendrils of its mane to the scales on its hide. It was stunning. Also, it was moving. I screamed and backed up, running into Adrian. He put an arm around me and held me as protectively as he could, though it was clear he was just as freaked out. The dragon opened its crystal eyelids and peered at the two of us with tiny golden eyes. It elicited a small croak and then began walking toward us, its small claws scraping against the rocks. â€Å"What the hell is that?†Adrian demanded. â€Å"Do you really think I know?†â€Å"You made it! Do something.†I started to ask what had happened to him looking out for me, but he had a point. I was the one who'd summoned this thing. No matter where we moved or backed up to, the dragon continued to follow and make a small, high-pitched screeching noise that sounded like nails on a chalkboard. I groped for my cell phone and tried to dial Ms. Terwilliger, but there was no reception out here. Darting over to the blanket, I grabbed the spell book and then hurried back to Adrian's side. I flipped to the index, looking up callistana. There I found two entries: Callistana – Summoning and Callistana – Banishing. You would've thought the two would be near each other in the book, but they were pages apart. I flipped to the latter and found the instructions brief and to the point: Once your callistana has been fed and rested, you may summon and banish it at will for a year and a day. A short incantation followed. I looked up at Adrian. â€Å"It says we have to feed it.†â€Å"Will that make it shut up?†he asked. His arm was around me again. â€Å"I honestly don't know.†â€Å"Maybe we can outrun it.†All my instincts about hiding the supernatural world kicked in. â€Å"We can't just leave it for some hiker to find! We have to get it some food.†Not that I had any clue what to feed it. Hopefully humans and vampires weren't on the menu. A look of determination crossed Adrian's features. In a great show of bravery he lunged for the picnic basket and actually managed to scoop the dragon up in it. He slammed down the lid, and the mewling faded but didn't stop. â€Å"Wow,†I said. â€Å"Manly and brave.†Adrian regarded the basket with dismay. â€Å"I just hope that thing doesn't breathe fire. At least it's contained. Now what do we do?†â€Å"Now we feed it.†I made a decision. â€Å"We take it to Pies and Stuff.†I didn't know if dragons ate pie, but that was the closest food source we had. Besides, I was pretty sure I'd be able to get a cell phone signal there. So, Adrian drove us back to the little diner while I gingerly held the noisy basket. He went inside, and I stayed in the car and tried to call Ms. Terwilliger. I was sent to voice mail and didn't even bother with formalities. Was she never near her phone anymore? â€Å"Call me now,†I said through gritted teeth. The dragon's screeching was really starting to get to me. Adrian returned in about ten minutes carrying two bags. I stared in amazement as he got in the car. â€Å"Did you buy out the store?†â€Å"I didn't know what kind it wanted,†he protested. Between the two bags, we had half a dozen slices of different kinds of pies. Each one's container was neatly labeled. â€Å"I really don't know either,†I said. Adrian sifted through the bags and pulled out a slice of coconut cream. â€Å"If I were a dragon, this is what I'd go for.†I didn't argue, mainly because that statement had no logical argument. He took the lid off the pie and then looked at me expectantly. With a gulp, I opened the basket's lid and prayed the dragon wouldn't climb out and claw my face off. Adrian quickly set the pie down in the basket. Nervously, we both leaned forward to watch. At first, the dragon looked as though it really would climb out after us. Then it noticed the pie. The little crystal creature sniffed at the slice, circled it a few times, and then began gnawing at the pie in teeny-tiny bites. Best of all, the screeching stopped. We watched in wonder as the dragon made its way through a third of the coconut cream pie. Then, without warning, it rolled over onto its back and began to snore. Adrian and I sat there, frozen, and then finally dared to look at each other. â€Å"I guess you were right about the flavor,†I said. â€Å"Do you think you can banish it now?†he asked. â€Å"Is it fed and rested enough?†I retrieved the spell book to double-check the incantation. â€Å"Time to find out.†I recited the words. Smoke fluttered from the dragon's body. He began to shimmer, and within moments, we were looking at an inert piece of smoky quartz. In another valiant display, Adrian picked it up but held it as far away as possible as he studied it. The ringing of my phone startled both of us, and he dropped the crystal back into the basket. I looked at the phone's screen and saw Ms. Terwilliger's name. â€Å"You made me summon a dragon!†I exclaimed. â€Å"I most certainly did not,†she responded. â€Å"Callistanas are a type of demon.†I froze. â€Å"A demon.†â€Å"Well,†she amended. â€Å"A very minor and generally benign kind.†I didn't reply for a while. â€Å"Sydney? Are you still there?†â€Å"You had me summon a demon,†I replied, voice stiff. â€Å"You know how I feel about evil and the supernatural. You've spent all this time trying to convince me that the magic we do is all for some greater good in the battle against evil, and yet you made me summon a creature of hell.†â€Å"Creature of hell?†She snorted. â€Å"Hardly. You know nothing about demons. I told you it's benign, didn't I? Callistanas can be very useful. They'll warn you if dark magic is nearby and will even try to defend you if you're attacked – not that they can do much damage.†I wasn't buying it. â€Å"If they're so useful, then why don't you have one?†â€Å"Oh, well, I'm at a level where I can sense dark magic on my own. That, and – if you'll forgive my language – callistanas are a real pain in the ass. They make the most irritating noise when they're hungry. Cats are more than adequate for my needs.†â€Å"Yeah,†I said. â€Å"I kind of noticed the noise part. I fed it some pie and turned it back into a rock.†â€Å"There, you see?†She sounded happier than I'd heard her in days. â€Å"Look at the progress you've made already. No matter what comes of this mess we've found ourselves in, I'm more convinced than ever that I made the right choice in guiding you on the magical path.†I had too much going on to really appreciate the compliment. â€Å"So what do I do now?†â€Å"It'll disappear on its own after a year and a day. Until then, you can call it when you need it. You can try to train it. And of course, you'll have to feed it. Whatever you choose to do, it will be loyal to you. It bonds with the first person it sees and will need to spend time with you . . . Sydney? Are you there?†I'd gone silent again. â€Å"The first person it sees?†I finally managed to ask. â€Å"Not the caster?†â€Å"Well, usually they're one and the same.†I glanced over at Adrian, who was eating a piece of blackberry pie while listening avidly to my side of the conversation. â€Å"What happens if there were two people there when it opened its eyes? Adrian was with me when I summoned it.†Now she paused. â€Å"Oh? Hmm, well, I probably should've said something before you cast the spell.†That had to be the understatement of the century. â€Å"You should've told me a lot of things before I cast it! What does it mean that the dragon – demon, whatever – saw both of us? Did it bond with both of us?†â€Å"Look at it this way,†Ms. Terwilliger said, after several moments of thought. â€Å"The callistana thinks of you two as its parents.â€
Subscribe to:
Posts (Atom)